reverse primer Search Results


99
tiangen biotech co reverse primer
Reverse Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reverse primer/product/tiangen biotech co
Average 99 stars, based on 1 article reviews
reverse primer - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

99
tiangen biotech co reverse primers
Reverse Primers, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reverse primers/product/tiangen biotech co
Average 99 stars, based on 1 article reviews
reverse primers - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

86
Thermo Fisher forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag
Forward Primer Reverse Primer Probe Kcnq1 Rs12296050 Gtgcttagactgtgcccg Gggagaccctgtctcgaa Ctcctgggctcctaacctttcacag, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

90
Microsynth ag forward primer for qpcr validation of rv2113/bcg_2130 expression
Forward Primer For Qpcr Validation Of Rv2113/Bcg 2130 Expression, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer for qpcr validation of rv2113/bcg_2130 expression/product/Microsynth ag
Average 90 stars, based on 1 article reviews
forward primer for qpcr validation of rv2113/bcg_2130 expression - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
DBI Bioscience specific forward primer and reverse primer using bestar sybrgreen qpcr mastermix
Specific Forward Primer And Reverse Primer Using Bestar Sybrgreen Qpcr Mastermix, supplied by DBI Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/specific forward primer and reverse primer using bestar sybrgreen qpcr mastermix/product/DBI Bioscience
Average 90 stars, based on 1 article reviews
specific forward primer and reverse primer using bestar sybrgreen qpcr mastermix - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Johns Hopkins HealthCare forward and reverse primers
Forward And Reverse Primers, supplied by Johns Hopkins HealthCare, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse primers/product/Johns Hopkins HealthCare
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Promega the primer extension reaction was performed with the primer extension system avian myeloblastosis virus reverse transcriptase kit
The Primer Extension Reaction Was Performed With The Primer Extension System Avian Myeloblastosis Virus Reverse Transcriptase Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/the primer extension reaction was performed with the primer extension system avian myeloblastosis virus reverse transcriptase kit/product/Promega
Average 90 stars, based on 1 article reviews
the primer extension reaction was performed with the primer extension system avian myeloblastosis virus reverse transcriptase kit - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GeNOsys Inc custom forward and reverse primers
Custom Forward And Reverse Primers, supplied by GeNOsys Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/custom forward and reverse primers/product/GeNOsys Inc
Average 90 stars, based on 1 article reviews
custom forward and reverse primers - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Promega oligo (dt) 18 primer with m-mlv reverse transcriptase
Oligo (Dt) 18 Primer With M Mlv Reverse Transcriptase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligo (dt) 18 primer with m-mlv reverse transcriptase/product/Promega
Average 90 stars, based on 1 article reviews
oligo (dt) 18 primer with m-mlv reverse transcriptase - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Biolegio bv reverse primer hbv cccr
Reverse Primer Hbv Cccr, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reverse primer hbv cccr/product/Biolegio bv
Average 90 stars, based on 1 article reviews
reverse primer hbv cccr - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation reverse primer caccacccaatttttgggca
Reverse Primer Caccacccaatttttgggca, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reverse primer caccacccaatttttgggca/product/GenScript corporation
Average 90 stars, based on 1 article reviews
reverse primer caccacccaatttttgggca - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Microsynth ag ef1a forward and reverse primers
Ef1a Forward And Reverse Primers, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ef1a forward and reverse primers/product/Microsynth ag
Average 90 stars, based on 1 article reviews
ef1a forward and reverse primers - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results