99
|
tiangen biotech co
reverse primer Reverse Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse primer/product/tiangen biotech co Average 99 stars, based on 1 article reviews
reverse primer - by Bioz Stars,
2026-06
99/100 stars
|
Buy from Supplier |
99
|
tiangen biotech co
reverse primers Reverse Primers, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse primers/product/tiangen biotech co Average 99 stars, based on 1 article reviews
reverse primers - by Bioz Stars,
2026-06
99/100 stars
|
Buy from Supplier |
86
|
Thermo Fisher
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag Forward Primer Reverse Primer Probe Kcnq1 Rs12296050 Gtgcttagactgtgcccg Gggagaccctgtctcgaa Ctcctgggctcctaacctttcacag, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag/product/Thermo Fisher Average 86 stars, based on 1 article reviews
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
90
|
Microsynth ag
forward primer for qpcr validation of rv2113/bcg_2130 expression Forward Primer For Qpcr Validation Of Rv2113/Bcg 2130 Expression, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer for qpcr validation of rv2113/bcg_2130 expression/product/Microsynth ag Average 90 stars, based on 1 article reviews
forward primer for qpcr validation of rv2113/bcg_2130 expression - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
DBI Bioscience
specific forward primer and reverse primer using bestar sybrgreen qpcr mastermix Specific Forward Primer And Reverse Primer Using Bestar Sybrgreen Qpcr Mastermix, supplied by DBI Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/specific forward primer and reverse primer using bestar sybrgreen qpcr mastermix/product/DBI Bioscience Average 90 stars, based on 1 article reviews
specific forward primer and reverse primer using bestar sybrgreen qpcr mastermix - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Johns Hopkins HealthCare
forward and reverse primers Forward And Reverse Primers, supplied by Johns Hopkins HealthCare, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse primers/product/Johns Hopkins HealthCare Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Promega
the primer extension reaction was performed with the primer extension system avian myeloblastosis virus reverse transcriptase kit The Primer Extension Reaction Was Performed With The Primer Extension System Avian Myeloblastosis Virus Reverse Transcriptase Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/the primer extension reaction was performed with the primer extension system avian myeloblastosis virus reverse transcriptase kit/product/Promega Average 90 stars, based on 1 article reviews
the primer extension reaction was performed with the primer extension system avian myeloblastosis virus reverse transcriptase kit - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
GeNOsys Inc
custom forward and reverse primers Custom Forward And Reverse Primers, supplied by GeNOsys Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/custom forward and reverse primers/product/GeNOsys Inc Average 90 stars, based on 1 article reviews
custom forward and reverse primers - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Promega
oligo (dt) 18 primer with m-mlv reverse transcriptase Oligo (Dt) 18 Primer With M Mlv Reverse Transcriptase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/oligo (dt) 18 primer with m-mlv reverse transcriptase/product/Promega Average 90 stars, based on 1 article reviews
oligo (dt) 18 primer with m-mlv reverse transcriptase - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Biolegio bv
reverse primer hbv cccr Reverse Primer Hbv Cccr, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse primer hbv cccr/product/Biolegio bv Average 90 stars, based on 1 article reviews
reverse primer hbv cccr - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
reverse primer caccacccaatttttgggca Reverse Primer Caccacccaatttttgggca, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse primer caccacccaatttttgggca/product/GenScript corporation Average 90 stars, based on 1 article reviews
reverse primer caccacccaatttttgggca - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Microsynth ag
ef1a forward and reverse primers Ef1a Forward And Reverse Primers, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ef1a forward and reverse primers/product/Microsynth ag Average 90 stars, based on 1 article reviews
ef1a forward and reverse primers - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |