99
|
tiangen biotech co
primer Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+primer/pm41846088-72-22-17?v=tiangen+biotech+co Average 99 stars, based on 1 article reviews
primer - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
99
|
tiangen biotech co
reverse primer Reverse Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+primer/pmc12099317-199-11-39?v=tiangen+biotech+co Average 99 stars, based on 1 article reviews
reverse primer - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
93
|
OriGene
human tert primers Human Tert Primers, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+primer/pmc12204606-110-0-4?v=OriGene Average 93 stars, based on 1 article reviews
human tert primers - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
86
|
Thermo Fisher
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag Forward Primer Reverse Primer Probe Kcnq1 Rs12296050 Gtgcttagactgtgcccg Gggagaccctgtctcgaa Ctcctgggctcctaacctttcacag, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+primer/10__1161_slash_circgenetics__113__000023-357-51-93?v=Thermo+Fisher Average 86 stars, based on 1 article reviews
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
90
|
TriLink
reverse dsdna primer Reverse Dsdna Primer, supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+primer/us11834756-1480-50-49?v=TriLink Average 90 stars, based on 1 article reviews
reverse dsdna primer - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
Seikagaku corporation
reverse transcriptase derived from the oligo-dt(12-18) primer and amv (avian myeloblastosis virus) Reverse Transcriptase Derived From The Oligo Dt(12 18) Primer And Amv (Avian Myeloblastosis Virus), supplied by Seikagaku corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+primer/us07067638-91-9-22?v=Seikagaku+corporation Average 90 stars, based on 1 article reviews
reverse transcriptase derived from the oligo-dt(12-18) primer and amv (avian myeloblastosis virus) - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
Promega
m-mlv reverse transcriptase, rnase h – point mutant dna polymerase M Mlv Reverse Transcriptase, Rnase H – Point Mutant Dna Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+primer/pmc00207015-66-36-46?v=Promega Average 90 stars, based on 1 article reviews
m-mlv reverse transcriptase, rnase h – point mutant dna polymerase - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
Promega
improm-ii reverse transcription kit with a random hexamer primer Improm Ii Reverse Transcription Kit With A Random Hexamer Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+primer/pm32534181-80-15-18?v=Promega Average 90 stars, based on 1 article reviews
improm-ii reverse transcription kit with a random hexamer primer - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
Promega
reverse transcriptase with oligo (dt) Reverse Transcriptase With Oligo (Dt), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+primer/pmc03856104-142-1-6?v=Promega Average 90 stars, based on 1 article reviews
reverse transcriptase with oligo (dt) - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
Promega
primer extension system-avian myeloblastosis virus reverse transcriptase kit Primer Extension System Avian Myeloblastosis Virus Reverse Transcriptase Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+primer/pmc01951922-74-6-14?v=Promega Average 90 stars, based on 1 article reviews
primer extension system-avian myeloblastosis virus reverse transcriptase kit - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
Promega
reverse transcription system kit with random primers Reverse Transcription System Kit With Random Primers, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+primer/pm36851551-49-25-26?v=Promega Average 90 stars, based on 1 article reviews
reverse transcription system kit with random primers - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
Promega
primer extension system-amv reverse transcriptase kit Primer Extension System Amv Reverse Transcriptase Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/reverse+primer/10__1128_slash_jb__185__17__5314___5319__2003-74-13-19?v=Promega Average 90 stars, based on 1 article reviews
primer extension system-amv reverse transcriptase kit - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |