reverse primer Search Results


99
tiangen biotech co primer
Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer/pm41846088-72-22-17?v=tiangen+biotech+co
Average 99 stars, based on 1 article reviews
primer - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
tiangen biotech co reverse primer
Reverse Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer/pmc12099317-199-11-39?v=tiangen+biotech+co
Average 99 stars, based on 1 article reviews
reverse primer - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

93
OriGene human tert primers
Human Tert Primers, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer/pmc12204606-110-0-4?v=OriGene
Average 93 stars, based on 1 article reviews
human tert primers - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

86
Thermo Fisher forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag
Forward Primer Reverse Primer Probe Kcnq1 Rs12296050 Gtgcttagactgtgcccg Gggagaccctgtctcgaa Ctcctgggctcctaacctttcacag, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer/10__1161_slash_circgenetics__113__000023-357-51-93?v=Thermo+Fisher
Average 86 stars, based on 1 article reviews
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

90
TriLink reverse dsdna primer
Reverse Dsdna Primer, supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer/us11834756-1480-50-49?v=TriLink
Average 90 stars, based on 1 article reviews
reverse dsdna primer - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Seikagaku corporation reverse transcriptase derived from the oligo-dt(12-18) primer and amv (avian myeloblastosis virus)
Reverse Transcriptase Derived From The Oligo Dt(12 18) Primer And Amv (Avian Myeloblastosis Virus), supplied by Seikagaku corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer/us07067638-91-9-22?v=Seikagaku+corporation
Average 90 stars, based on 1 article reviews
reverse transcriptase derived from the oligo-dt(12-18) primer and amv (avian myeloblastosis virus) - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Promega m-mlv reverse transcriptase, rnase h – point mutant dna polymerase
M Mlv Reverse Transcriptase, Rnase H – Point Mutant Dna Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer/pmc00207015-66-36-46?v=Promega
Average 90 stars, based on 1 article reviews
m-mlv reverse transcriptase, rnase h – point mutant dna polymerase - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Promega improm-ii reverse transcription kit with a random hexamer primer
Improm Ii Reverse Transcription Kit With A Random Hexamer Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer/pm32534181-80-15-18?v=Promega
Average 90 stars, based on 1 article reviews
improm-ii reverse transcription kit with a random hexamer primer - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Promega reverse transcriptase with oligo (dt)
Reverse Transcriptase With Oligo (Dt), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer/pmc03856104-142-1-6?v=Promega
Average 90 stars, based on 1 article reviews
reverse transcriptase with oligo (dt) - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Promega primer extension system-avian myeloblastosis virus reverse transcriptase kit
Primer Extension System Avian Myeloblastosis Virus Reverse Transcriptase Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer/pmc01951922-74-6-14?v=Promega
Average 90 stars, based on 1 article reviews
primer extension system-avian myeloblastosis virus reverse transcriptase kit - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Promega reverse transcription system kit with random primers
Reverse Transcription System Kit With Random Primers, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer/pm36851551-49-25-26?v=Promega
Average 90 stars, based on 1 article reviews
reverse transcription system kit with random primers - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Promega primer extension system-amv reverse transcriptase kit
Primer Extension System Amv Reverse Transcriptase Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/reverse+primer/10__1128_slash_jb__185__17__5314___5319__2003-74-13-19?v=Promega
Average 90 stars, based on 1 article reviews
primer extension system-amv reverse transcriptase kit - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results